View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1355_1D_low_81 (Length: 203)

Name: NF1355_1D_low_81
Description: NF1355_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1355_1D_low_81
NF1355_1D_low_81
[»] chr8 (1 HSPs)
chr8 (112-194)||(36371347-36371429)


Alignment Details
Target: chr8 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 112 - 194
Target Start/End: Complemental strand, 36371429 - 36371347
Alignment:
112 tctatgattttaagtcaacttatatgtatcattcaaaatttacgatattttatacgcaatcatatttaatatattatagaatt 194  Q
    |||||| |||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
36371429 tctatgcttttaagtcaacttatatatatcattcaaaatttacgatattttatatgcaatcatatttaatatattatagaatt 36371347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University