View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1355_1D_low_83 (Length: 203)

Name: NF1355_1D_low_83
Description: NF1355_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1355_1D_low_83
NF1355_1D_low_83
[»] chr3 (1 HSPs)
chr3 (18-197)||(53810876-53811054)


Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 53810876 - 53811054
Alignment:
18 aacatgaaagttgttatagttatctaatatgtctctacattgatctatgatggacacatagtccgttcaattagattaacattgatcataccatcaagta 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53810876 aacatgaaagttgttatagttatctaatatgtctctacattgatctatgatggacacatagtccgttcaattagattaacattgatcataccatcaagta 53810975  T
118 tcaactatacttgcttacaatctacttcatagacaatattttgaatacccaaagctgttaatccattgagttgaaaccac 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
53810976 tcaactatacttgcttacaatctacttcatagacaatattttgaatacccaaagctg-taatccattgagttgaaaccac 53811054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University