View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1355_1D_low_84 (Length: 201)
Name: NF1355_1D_low_84
Description: NF1355_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1355_1D_low_84 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 11833769 - 11833583
Alignment:
| Q |
1 |
gaacaaagagatctagaaagcactaggaagaaatctttctaccatttcacccataaccgttatccatctaacgacaatgcatgacgtcaatgacatggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11833769 |
gaacaaagagatctagaaagcactaggaagaaatctctctaccatttcacccataaccgttatccatctaacgacaatgcatgacgtcgatgacatggat |
11833670 |
T |
|
| Q |
101 |
tttgaatgtggggcattatcgtgtgaacggtggctttgccactatgcatagttttccatactttcggatctgcaacgttgatgtcca |
187 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
11833669 |
tttgaatgtggggcattatcgtgtcaacggtggcttcgccactatgcatagctttccatactttcggatctgcaacgttgatgtcca |
11833583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 156 - 197
Target Start/End: Original strand, 7677836 - 7677877
Alignment:
| Q |
156 |
ccatactttcggatctgcaacgttgatgtccatctcattgct |
197 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7677836 |
ccatgctttcggatctgcaacgttgatgtccaaatcattgct |
7677877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University