View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1356-INSERTION-1 (Length: 429)
Name: NF1356-INSERTION-1
Description: NF1356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1356-INSERTION-1 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 392; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 392; E-Value: 0
Query Start/End: Original strand, 7 - 429
Target Start/End: Complemental strand, 6624414 - 6623994
Alignment:
Q |
7 |
agctttcaccaccaatttgttgccagtagttactttgcgcctattaatagtcttggaatctctgtttccacagctaactgggcattctgctgatctgtct |
106 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6624414 |
agctttcaccaccaatttgctgccagtagttactttgcacctattaatagtcttggaatctctgtttccacagctaactgggcattctgctgatctgtct |
6624315 |
T |
 |
Q |
107 |
ttgaaaggaagtccatattggatggctccagaggtatatttgtatatatttgaactctacattactcttttatgtatcacgtgttctttactcaaacttg |
206 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
6624314 |
ttgaaaggaagtccatattggatggctccagaggtatatttgtatat--ttgaactctaaattactctcttatgtatcacgtgttctttactcaaacttg |
6624217 |
T |
 |
Q |
207 |
cttctcatacagcttatgcaagcggtcatacataaagataacagctctgatctagcttttgcaattgatatttggagtttgggttgtacaattattgaaa |
306 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6624216 |
cttctcatacagcttatgcaagcggtcatacataaagataacagctctgatctagcttttgcaattgatatttggagtttgggttgtacaattattgaaa |
6624117 |
T |
 |
Q |
307 |
tgttcacgggaaagcctccttggagtgaatatgaaggagtaagcccctacaataaaattatggctcctgtcaatttttattcaggccacttcattataca |
406 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6624116 |
tgttcacgggaaagcctccttggagtgaatatgaaggagtaagcccctacaataaaattctggctcctgtcaatttttattcaggccacttcattataca |
6624017 |
T |
 |
Q |
407 |
tatcataatttgatttcccatta |
429 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
6624016 |
tatcataatttgatttcccatta |
6623994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University