View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1356-INSERTION-4 (Length: 112)
Name: NF1356-INSERTION-4
Description: NF1356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1356-INSERTION-4 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 5e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 5e-44
Query Start/End: Original strand, 11 - 112
Target Start/End: Complemental strand, 26351267 - 26351166
Alignment:
| Q |
11 |
agtgctttgcaggtttttagggactcatccttagttccatacactattcgcaaccgttggcataactggattcaaggtgtaatttcaattctttcatctc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||||||||||||||||||||||||||| |
|
|
| T |
26351267 |
agtgctttgcaggtttttagggactcatccttagttccatacactattcgcaaccgttggcataattgtactcaaggtgtaatttcaattctttcatctc |
26351168 |
T |
|
| Q |
111 |
at |
112 |
Q |
| |
|
|| |
|
|
| T |
26351167 |
at |
26351166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University