View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13561_high_31 (Length: 239)
Name: NF13561_high_31
Description: NF13561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13561_high_31 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 41231036 - 41230815
Alignment:
| Q |
18 |
agagacagaggaaaagcgaccaatttggagaatggtcggtcgagtgaagctgatctaacagaaaactgaacataaaacccgtaaagcttccagaaggagc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41231036 |
agagacagaggaaaagcgaccaatttggagaatggtcggtcgagtgaagctgatctaacagaaaactgaacataaaacccgtaaagcttccagaaggagc |
41230937 |
T |
|
| Q |
118 |
tccttcctgcaaaattcatacgcttgataactttcttgcatccctcccttcaaggtagatttttaaggagatgcagcagcttagagtagatttaatcaac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
41230936 |
tccttcctgcaaaattcatacgcttgataactttcttgcatccctcccttcaaggtagatttttaaggagatgcagcagcttagagtagactcaatcaac |
41230837 |
T |
|
| Q |
218 |
cgattactactagaagaaattt |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41230836 |
cgattactactagaagaaattt |
41230815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 61 - 92
Target Start/End: Complemental strand, 6110339 - 6110308
Alignment:
| Q |
61 |
gtgaagctgatctaacagaaaactgaacataa |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6110339 |
gtgaagctgatctaacagaaaactgaacataa |
6110308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University