View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13561_high_33 (Length: 236)
Name: NF13561_high_33
Description: NF13561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13561_high_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 24 - 220
Target Start/End: Original strand, 7502118 - 7502314
Alignment:
| Q |
24 |
ccatgacactagacgtcactttccccgcccggtgcttgcttctgcacttgttcttccgacgaccactgctataacaagcagaattagaacaagttgatgg |
123 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7502118 |
ccatgacactagacgtcactttccccgcctggtgcttgcttctgcacttgttcttccgacgaccactgctataacaagcagaattagaacaagttgatgg |
7502217 |
T |
 |
| Q |
124 |
ttgtgatatgtgaattcaataaagttctgattttgaagtttaccgcttcaatgcacatagggccctcaccagaaaagagtgcgggccagagccaaac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7502218 |
ttgtgatatgtgaattcaataaagttctgattttgaagtttacctcttcaatgcacatagggccctcaccagaaaagagtgcgggccagagccaaac |
7502314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 129 - 203
Target Start/End: Complemental strand, 8139524 - 8139450
Alignment:
| Q |
129 |
atatgtgaattcaataaagttctgattttgaagtttaccgcttcaatgcacatagggccctcaccagaaaagagt |
203 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||| ||||||| |||||||| | |||||||||||||| |
|
|
| T |
8139524 |
atatgtgaattccataaagttttgattttgaaggttacctgttcaatgagcatagggctcccaccagaaaagagt |
8139450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 80 - 167
Target Start/End: Original strand, 7499127 - 7499215
Alignment:
| Q |
80 |
cgacgaccactgctataacaagcagaattagaacaagttgatggttgtga-tatgtgaattcaataaagttctgattttgaagtttacc |
167 |
Q |
| |
|
|||||||||||| || ||||| |||||| | ||| ||| |||||||||| ||||||||||| |||||||| ||||||||||| ||||| |
|
|
| T |
7499127 |
cgacgaccactgttagaacaatcagaataaaaactcgtttatggttgtgaatatgtgaattccataaagttttgattttgaaggttacc |
7499215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 24 - 78
Target Start/End: Complemental strand, 8139653 - 8139599
Alignment:
| Q |
24 |
ccatgacactagacgtcactttccccgcccggtgcttgcttctgcacttgttctt |
78 |
Q |
| |
|
||||||||||||| || |||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
8139653 |
ccatgacactagatgtgactttccctgcccggcacttgcttctgcacttgttctt |
8139599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University