View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13561_high_38 (Length: 217)

Name: NF13561_high_38
Description: NF13561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13561_high_38
NF13561_high_38
[»] chr7 (1 HSPs)
chr7 (18-147)||(43672130-43672259)


Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 18 - 147
Target Start/End: Complemental strand, 43672259 - 43672130
Alignment:
18 agaagaacgttgtaagatgttgtgtgggttttaaggtttaaggaagtgaagtggttgagaacaaagttagcggtgtcggagttgggtttagttccggcga 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43672259 agaagaacgttgtaagatgttgtgtgggttttaaggtttaaggaaatgaagtggttgagaacaaagttagcggtgtcggagttgggtttagttccggcga 43672160  T
118 ggtgagggtgcatggtgagggtgcggaggt 147  Q
    ||||||||||||||||||||||||||||||    
43672159 ggtgagggtgcatggtgagggtgcggaggt 43672130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University