View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13561_high_39 (Length: 217)
Name: NF13561_high_39
Description: NF13561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13561_high_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 11624357 - 11624557
Alignment:
| Q |
1 |
gtataaggccaaggaacactagtcatacatggaacttgaggaatgaaaccattattttgctgtggcaatgattcttgtgtcatgtttttaccactttcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11624357 |
gtataaggccaaggaacactagtcatacatggaacttggggaatgaaaccattatttttctgtggcaatgattcttgtgtcatgtttttaccactttcct |
11624456 |
T |
 |
| Q |
101 |
ccatggattttgaaactgtaacagaagacgcactcgaaaaacgatcaccattatttcgagtgtcgttaagaacctttttctctgcaggattgagatcatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11624457 |
ccatggattttgaaactgtaacagaagacgcacttgaaaaacgatcaccattatttcgagtgtcgttaagaacctttttctctgcaggattgagatcatt |
11624556 |
T |
 |
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
11624557 |
t |
11624557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University