View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13561_low_29 (Length: 244)
Name: NF13561_low_29
Description: NF13561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13561_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 35066575 - 35066796
Alignment:
| Q |
1 |
tgggtatgacaagggttaagacgagggttaacccttggaaaacatatttgaacctctaagaaatttgaggcagaaaacctccctccatttcaaatttgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35066575 |
tgggtatgacaagggttaagacgagggttaacccttggaaaacatacttgaacctctgagaaatttgaggcagaaaacctccctccatttcaaatttgtt |
35066674 |
T |
|
| Q |
101 |
tgaaactgagtgatgtaacacaacacatgggttgtcagtgttttgccagggcctaaaccagggattgtcccctgcaaatggagagagaatctttgcaccc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||||||||||||||||||||||||| |
|
|
| T |
35066675 |
tgaaactgagtgatgtaacacaacacatgggttgtcagtgttttgccagggcctaaaccagggattgccctcggcaaatggagagagaatctttgcaccc |
35066774 |
T |
|
| Q |
201 |
atgaaaatgaagagatatttgt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35066775 |
atgaaaatgaagagatatttgt |
35066796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University