View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13561_low_30 (Length: 242)
Name: NF13561_low_30
Description: NF13561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13561_low_30 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 22 - 242
Target Start/End: Complemental strand, 24005969 - 24005749
Alignment:
| Q |
22 |
gggccccattatgttactcactcacagctctttgtttcgacgatgataccgtgaaagacgctgaaggcttcaatcgcttctgtggttttgtagataaact |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
24005969 |
gggccccattatgttactcactcacagctcttcgtttcgacgatgataccgtgaaaaacgttgatagcttcaatcgcttctgtggttttgtagataaact |
24005870 |
T |
 |
| Q |
122 |
catgctctttccttctgcggccaaccaacctatcaaaacgtttcacctcaaactctctcaattttataaagttgatcatcaaagcttccatgcatgggta |
221 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
24005869 |
catgctctttccttctgcgaccaaccaacctatcaaaacgtttcacctcaaactctctcgattttataaggttgatcatcaaagcttctatgcatgggta |
24005770 |
T |
 |
| Q |
222 |
gaagccataaaacaacgccgc |
242 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
24005769 |
gaagccataaaactacgccgc |
24005749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 22 - 226
Target Start/End: Complemental strand, 23941137 - 23940933
Alignment:
| Q |
22 |
gggccccattatgttactcactcacagctctttgtttcgacgatgataccgtgaaagacgctgaaggcttcaatcgcttctgtggttttgtagataaact |
121 |
Q |
| |
|
|||||||| | || |||||||||||||||||| | ||| ||| |||||| |||||||| ||||| ||||||||||||||||| ||||||||||||| || |
|
|
| T |
23941137 |
gggccccactctgctactcactcacagctcttcgcttcaacggtgatacagtgaaagatgctgacagcttcaatcgcttctgtcgttttgtagataagct |
23941038 |
T |
 |
| Q |
122 |
catgctctttccttctgcggccaaccaacctatcaaaacgtttcacctcaaactctctcaattttataaagttgatcatcaaagcttccatgcatgggta |
221 |
Q |
| |
|
|||||||| |||||||||| |||||||||| ||||||||||||||| ||| ||||||| | |||| ||||||||| |||||||||| ||||||||||| |
|
|
| T |
23941037 |
catgctctctccttctgcgaccaaccaacccatcaaaacgtttcacttcatcctctctcgaggttatgaagttgatcgtcaaagcttcgatgcatgggta |
23940938 |
T |
 |
| Q |
222 |
gaagc |
226 |
Q |
| |
|
||||| |
|
|
| T |
23940937 |
gaagc |
23940933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University