View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13561_low_32 (Length: 240)
Name: NF13561_low_32
Description: NF13561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13561_low_32 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 7812592 - 7812372
Alignment:
| Q |
17 |
aatttttatagattggaaatatgaagctatttaatattacagtaaatataattttgaaaagtatatatacgttgaattaaatttatttgatgaattattt |
116 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7812592 |
aatttctatagattggaaatatgtagctatttaatattacagtaaatataattttgaaaagtatatatacgttgaattaaatttatttgatgaattattt |
7812493 |
T |
|
| Q |
117 |
ttgttgtgaatctttgctctttagagctgttggttgtggggcactaatctcatgtaaaagaatttttatagtactgttaatttacctgccaaaattacac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7812492 |
ttgttgtgaatctttgctctttagagctgttggttgtggggcactaatctcatgtaaaagaatttttatag---tgttaatttacctgccaaaattacac |
7812396 |
T |
|
| Q |
217 |
caatgaagaaaataatacaacaac |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
7812395 |
caatgaagaaaataatacaacaac |
7812372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University