View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13561_low_40 (Length: 217)
Name: NF13561_low_40
Description: NF13561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13561_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 18 - 147
Target Start/End: Complemental strand, 43672259 - 43672130
Alignment:
| Q |
18 |
agaagaacgttgtaagatgttgtgtgggttttaaggtttaaggaagtgaagtggttgagaacaaagttagcggtgtcggagttgggtttagttccggcga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43672259 |
agaagaacgttgtaagatgttgtgtgggttttaaggtttaaggaaatgaagtggttgagaacaaagttagcggtgtcggagttgggtttagttccggcga |
43672160 |
T |
 |
| Q |
118 |
ggtgagggtgcatggtgagggtgcggaggt |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43672159 |
ggtgagggtgcatggtgagggtgcggaggt |
43672130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University