View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13562_high_15 (Length: 275)
Name: NF13562_high_15
Description: NF13562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13562_high_15 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 13 - 275
Target Start/End: Original strand, 40410786 - 40411042
Alignment:
| Q |
13 |
aatatgcaccataatctcttttgcagatgcaataaatttgagagataaaagtatgattttttagttgatagcaagacaaaattgttagctggaatcaaag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40410786 |
aatatgcaccataatctcttttgcagatgcaataaatttgagagataaaagtatgactttttagttgatagcaagacaaatttgttagctggaatcaaag |
40410885 |
T |
 |
| Q |
113 |
tttggacttcatttttagtactcctttcaacatcatcttgacaatattaataatatcagttagctacatatactatctctgacaacggataaaaggtatg |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40410886 |
tttggacttcatttttagtact--gatcaacatcatcttgacaatattaataatatcagttagctacatatactacctctgacaacggataaaaggtatg |
40410983 |
T |
 |
| Q |
213 |
atctaacttagaacatatatacttccatatattattgccctcccaactattaaatcattgaga |
275 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40410984 |
atctaacttagaac----atacttccatatattattgccctcccaactattaaatcatagaga |
40411042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University