View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13562_high_17 (Length: 242)
Name: NF13562_high_17
Description: NF13562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13562_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 228
Target Start/End: Original strand, 7463510 - 7463723
Alignment:
| Q |
18 |
ccagcctaggttgtcgctttttaaattaatttcactatattgttgctaattttgttataggnnnnnnnttgtttcgtattcgtatttttgttaaataatg |
117 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7463510 |
ccagcctaggttgtcactttttaaattaatttcactatattgttgctaattttgtaataggaaaaaaattgtttcgtattcgtatttttgttaaataatg |
7463609 |
T |
 |
| Q |
118 |
ttgttttcacatgagcaaagctccttgcaaattttcacgtgcatatactcgtatgaaacttcatttaaatacactaatga---gttaaatcaactaaact |
214 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7463610 |
ttgttttcacatgggcaaagctccttgcaaattttcacgtgcatatactcgtatgaaacttcatttaaatacactaatgaattgttaaatcaactaaact |
7463709 |
T |
 |
| Q |
215 |
aaactgttttcaca |
228 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7463710 |
aaactgttttcaca |
7463723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University