View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13562_low_11 (Length: 435)
Name: NF13562_low_11
Description: NF13562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13562_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 25 - 416
Target Start/End: Complemental strand, 6274807 - 6274419
Alignment:
| Q |
25 |
taagattgcactacatattaaataggatacttaaactaaatataaatatcaaatttgtactcatcataagtgataataacactcaaaatactgctcaaat |
124 |
Q |
| |
|
|||||| ||||| ||||| | |||||| |||| |||||| |||||||||||||||||||||||| |||||| ||||| ||||||||||| |||||||| |
|
|
| T |
6274807 |
taagatagcactccatatcatataggagacttgaactaattataaatatcaaatttgtactcat---aagtgacaataaaactcaaaatacagctcaaat |
6274711 |
T |
 |
| Q |
125 |
aaactaaaacgagtgaactttgctttatttctgggattagtctaaagactaacctatttatctctcttaatccaacagctctgcagcatgtggcatcact |
224 |
Q |
| |
|
||||||||| ||||||| ||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |||||| ||||||||| |
|
|
| T |
6274710 |
aaactaaaatgagtgaaattttctttatttctgggattagtctaaagaccaacctatttatctctcttaatccaacggctctcgagcatgcggcatcact |
6274611 |
T |
 |
| Q |
225 |
cttgaaatcggtctatttcgaagcagcactaatcgctgcatatcgagatttgaaaaagccgaggagtccatcttttggagggagattctctttcacaata |
324 |
Q |
| |
|
| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6274610 |
cctgaaatcagtctatttcgaagcagcactaatcgctgcatatcgagatttgaaaaagccgaggagtccatcttttggagggagattctctttcacaata |
6274511 |
T |
 |
| Q |
325 |
ggatgattgttgaattcttgactccacttatagagcttaggaaatttgtcactgctaagaacctttaaccctacagcttcttcaatcacagg |
416 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6274510 |
ggatgattgttgaattcttgactccacttatagagcttaggaaatttgtcactgctaagaacctttaaccctacagcttcttcaatcgcagg |
6274419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University