View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13564_high_26 (Length: 278)
Name: NF13564_high_26
Description: NF13564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13564_high_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 5 - 131
Target Start/End: Complemental strand, 39936174 - 39936048
Alignment:
| Q |
5 |
cagcacgagatctctttgtagatgatccactgatannnnnnnnggcttccgcagattcaaaatcaacatccttttacagaaatacaattagaaataagaa |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39936174 |
cagcacgagatctctttgtagatgatccactgatattttttttggcttccgcagattcaaaatcaacatccttttacagaaatacaattagaaataagaa |
39936075 |
T |
|
| Q |
105 |
tatagaaattgcaaataatctatgttt |
131 |
Q |
| |
|
|||||||||||||||||| |||||||| |
|
|
| T |
39936074 |
tatagaaattgcaaataaactatgttt |
39936048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 209 - 260
Target Start/End: Complemental strand, 39935970 - 39935919
Alignment:
| Q |
209 |
caagagacagtacaagaataaagaataaatgggtgttagattagtaaggatt |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39935970 |
caagagacagtacaagaataaagaataaatgggtgttagattagtaaggatt |
39935919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University