View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13564_high_27 (Length: 248)
Name: NF13564_high_27
Description: NF13564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13564_high_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 18741858 - 18741643
Alignment:
| Q |
18 |
agttggggtttagggtaagggtggggtctagtgcttgtaggagatacaaagatttatggtttcatggcacacgctataacattttgttggtcttgttatg |
117 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18741858 |
agttggggtttagggtaggggtggggtctagtgcttgtaggagatacaaagatttctggtttcatggcacacgctgtaacattttgttggtcttgttatg |
18741759 |
T |
|
| Q |
118 |
gggcctctcaatgtgacaatagtcctttggctctatattttaatttttgggttagtagatatttgaaagaggagtataagagagatagaatgtttgtgct |
217 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| ||| |
|
|
| T |
18741758 |
gggcctcccaatgtgacaa---tcctttggctctatattttaatttttgggttagtagatatttgaaagaggaatctaagagagatagaatgtttgcgct |
18741662 |
T |
|
| Q |
218 |
tcctggtcatctaggttct |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
18741661 |
tcctggtcatctaggttct |
18741643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University