View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13564_high_34 (Length: 227)
Name: NF13564_high_34
Description: NF13564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13564_high_34 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 71 - 227
Target Start/End: Complemental strand, 3447856 - 3447700
Alignment:
| Q |
71 |
ttgttgtgagttttgttaagtttaagttgtcgatcatcatttcttgttctattgacttttttcttacataaaggcttcagactcaatgcatattaagagg |
170 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
3447856 |
ttgttgtgagttttgttatgtttaagttgtggatcataatttcttgttcttttgacttttttcttacataaaggcttcagactcaatgaatatgaagagg |
3447757 |
T |
|
| Q |
171 |
acagatatttgtcattgttaacgaatatcaaatataagattgtcggcgaacatgtaa |
227 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3447756 |
acagatatttgtcgttgttaacgaatatcaaatataagattgtcggcgaacatgtaa |
3447700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 41 - 74
Target Start/End: Complemental strand, 3447943 - 3447910
Alignment:
| Q |
41 |
tagtctcttactactcagaccaatcgcatgttgt |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
3447943 |
tagtctcttactactcagaccaatcgcatgttgt |
3447910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University