View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13564_low_22 (Length: 338)
Name: NF13564_low_22
Description: NF13564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13564_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 84 - 320
Target Start/End: Complemental strand, 30380866 - 30380630
Alignment:
| Q |
84 |
cccctttgttgttcttggtattaagtaattctgggatgattggtattggttcttttggggtgaaggaatgtagttggaaaaagtggttcttttgaataat |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30380866 |
cccctttgttgttcttggtattaagtaattctgggatgattgatattggttcttttggggtgaaggaatgtagttggaaaaagtggttcttttgaataat |
30380767 |
T |
 |
| Q |
184 |
tcctcattcttgaggatgtttcaaatttcttaaatttgattcattttgatccattacccccaatttgcatttcatcttgattactagattgtgaaatttt |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30380766 |
tcctcattcttgaggatgtttcaaatttcttaaatttgattcattttgatccattacccccaatttgcatttcatcttgattactagattgtgaaatttt |
30380667 |
T |
 |
| Q |
284 |
gttgggttttgtggatttttgaagaaagttaggattt |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30380666 |
gttgggttttgtggatttttgaagaaagttaggattt |
30380630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 8 - 50
Target Start/End: Complemental strand, 30380943 - 30380901
Alignment:
| Q |
8 |
caccacagataccatctcttttcctaccttattctgttttgcc |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30380943 |
caccacagataccatctcttttcctaccttattctgttttgcc |
30380901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University