View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13564_low_28 (Length: 278)

Name: NF13564_low_28
Description: NF13564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13564_low_28
NF13564_low_28
[»] chr7 (2 HSPs)
chr7 (5-131)||(39936048-39936174)
chr7 (209-260)||(39935919-39935970)


Alignment Details
Target: chr7 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 5 - 131
Target Start/End: Complemental strand, 39936174 - 39936048
Alignment:
5 cagcacgagatctctttgtagatgatccactgatannnnnnnnggcttccgcagattcaaaatcaacatccttttacagaaatacaattagaaataagaa 104  Q
    |||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39936174 cagcacgagatctctttgtagatgatccactgatattttttttggcttccgcagattcaaaatcaacatccttttacagaaatacaattagaaataagaa 39936075  T
105 tatagaaattgcaaataatctatgttt 131  Q
    |||||||||||||||||| ||||||||    
39936074 tatagaaattgcaaataaactatgttt 39936048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 209 - 260
Target Start/End: Complemental strand, 39935970 - 39935919
Alignment:
209 caagagacagtacaagaataaagaataaatgggtgttagattagtaaggatt 260  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
39935970 caagagacagtacaagaataaagaataaatgggtgttagattagtaaggatt 39935919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University