View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13564_low_34 (Length: 235)
Name: NF13564_low_34
Description: NF13564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13564_low_34 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 235
Target Start/End: Original strand, 27329101 - 27329317
Alignment:
| Q |
19 |
gtcttcagataattaccaatgggaaatacaagagtattgttcatcgtgctgtggtgatgaataagaaagctgcaagaatttctgttggtacagcacatgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27329101 |
gtcttcagataattaccaatgggaaatacaagagtattgttcatcgtgctgtggtgatgaataagaaagctgcaagaatttctgttgggacagcacatgg |
27329200 |
T |
 |
| Q |
119 |
gcccacacttgacaccattgtcacccctgcaccagagctgcttagcaaggataacccctcagcatatagaggcattacatacagagattacttgcagctt |
218 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27329201 |
gcccactcttgacaccattgtcacccctgcaccagagctgcttagcaaggataacccctcagcatatagaggcattacatacagagattacttgcagctt |
27329300 |
T |
 |
| Q |
219 |
caacaaagtcgtgaatt |
235 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
27329301 |
caacaaagtcgtgaatt |
27329317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University