View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13564_low_35 (Length: 230)
Name: NF13564_low_35
Description: NF13564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13564_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 55 - 214
Target Start/End: Complemental strand, 21129530 - 21129373
Alignment:
| Q |
55 |
attcaaatatacttgttgctagcaatgagtagcaacatacccttttaacgacactcttctattagttgaaattcatacacgtctcaccaaactacatggg |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21129530 |
attcaaatatacttgttgctagcaatgagtagcaacatacccttttaacgacactcttctattagttgaaattcatacacgtctcaccaaactacgtggg |
21129431 |
T |
 |
| Q |
155 |
acacgtgtaatttagttagacttcttttttctaaaatagcgaaatcaatttaatttcaac |
214 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||| ||||| |||||||| |||| |
|
|
| T |
21129430 |
acacgtgtaatttagtgagact--ttttttctaaaatagcaaaatccatttaattacaac |
21129373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 21129605 - 21129543
Alignment:
| Q |
1 |
gatatctattaaccatcgaaattgtgtgcggaaagatatacatgattttcaaacattcaaata |
63 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
21129605 |
gatatctattaaccatcgaaattgtgtgtggaaagatatacatgattttgaaacattcaaata |
21129543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University