View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13564_low_36 (Length: 227)

Name: NF13564_low_36
Description: NF13564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13564_low_36
NF13564_low_36
[»] chr4 (2 HSPs)
chr4 (71-227)||(3447700-3447856)
chr4 (41-74)||(3447910-3447943)


Alignment Details
Target: chr4 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 71 - 227
Target Start/End: Complemental strand, 3447856 - 3447700
Alignment:
71 ttgttgtgagttttgttaagtttaagttgtcgatcatcatttcttgttctattgacttttttcttacataaaggcttcagactcaatgcatattaagagg 170  Q
    |||||||||||||||||| ||||||||||| |||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |||| ||||||    
3447856 ttgttgtgagttttgttatgtttaagttgtggatcataatttcttgttcttttgacttttttcttacataaaggcttcagactcaatgaatatgaagagg 3447757  T
171 acagatatttgtcattgttaacgaatatcaaatataagattgtcggcgaacatgtaa 227  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
3447756 acagatatttgtcgttgttaacgaatatcaaatataagattgtcggcgaacatgtaa 3447700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 41 - 74
Target Start/End: Complemental strand, 3447943 - 3447910
Alignment:
41 tagtctcttactactcagaccaatcgcatgttgt 74  Q
    ||||||||||||||||||||||||||||||||||    
3447943 tagtctcttactactcagaccaatcgcatgttgt 3447910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University