View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13564_low_37 (Length: 210)
Name: NF13564_low_37
Description: NF13564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13564_low_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 19 - 159
Target Start/End: Complemental strand, 12995837 - 12995697
Alignment:
| Q |
19 |
atgtagctacctcttccagccagccatgcgctccccgatatgttcccttccttgtcctatactccactagatatatcatatatacttagccatggatatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12995837 |
atgtagctacctcttccagccagccatgcgctccccgatatgttcccttccttgtcctatactccactagatatatcatatatacttagccatggatatt |
12995738 |
T |
|
| Q |
119 |
agttatggcttttgttttcattttcttataattctaatgga |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12995737 |
agttatggcttttgttttcattttcttataattctaatgga |
12995697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 19 - 159
Target Start/End: Complemental strand, 13070490 - 13070350
Alignment:
| Q |
19 |
atgtagctacctcttccagccagccatgcgctccccgatatgttcccttccttgtcctatactccactagatatatcatatatacttagccatggatatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13070490 |
atgtagctacctcttccagccagccatgcgctccccgatatgttcccttccttgtcctatactccactagatatatcatatatacttagccatggatatt |
13070391 |
T |
|
| Q |
119 |
agttatggcttttgttttcattttcttataattctaatgga |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13070390 |
agttatggcttttgttttcattttcttataattctaatgga |
13070350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University