View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13565_high_27 (Length: 324)
Name: NF13565_high_27
Description: NF13565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13565_high_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 32 - 310
Target Start/End: Original strand, 2415082 - 2415360
Alignment:
| Q |
32 |
tggagtatattacattggcaaggcgaccatcggacatgccagaattggatctccatttgatttgttggtcaggagggagccttcctgacctctggccttg |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2415082 |
tggagtatattacattggcaaggcgaccatcggacatgccagaattggatctccatttgatttgttggtcaggagggagccttcctgacctctggccttg |
2415181 |
T |
 |
| Q |
132 |
aaaaaacaataaggatttagccaaagcttctctatagtttggtttgcattggacattttcaacaaccagcaagcatgtaagaagtaacaagaaaagcaag |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2415182 |
aaaaaacaataaggatttagccaaagcttctctatagtttggtttgcattggacattttcaacaaccagcaagcatgtaagaagtaacaagaaaaccaag |
2415281 |
T |
 |
| Q |
232 |
gaagttctcattatgctcactggttgttgtcttgtgtgacccttttgcagaatcaacaccaaagtgcttttggctttat |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2415282 |
gaagttctcattatgctcactggttgttgtcttgtgtgacccttttgcagaatcaacaccaaagtgcttttggctttat |
2415360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University