View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13565_high_32 (Length: 252)
Name: NF13565_high_32
Description: NF13565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13565_high_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 48171752 - 48171519
Alignment:
| Q |
1 |
gtcttggatactgaaggtgattattatgataatgaaaaccaacatgattatagttcacaagatgctaaagaaacaaaggagttctactccaagtcaagct |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48171752 |
gtctcggatactgaaggtgattattatgataatgaaaaccaacatgattatagttcacaagatgctaaagaaacaaaggagttctactccaagtcaagct |
48171653 |
T |
 |
| Q |
101 |
gcaaaagcagcaccaaatcaaggaaggggaccgtttcttctggccgaaggaacaactccagttcagattcagaaaatgaccacgaaagcagtaggagaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48171652 |
gcaaaagcagcaccaaatcaaggaaggggaccgtttcttctggccgaaggaacaactccagttcagattcagaaaatgaccacgaaagcagtaggagaaa |
48171553 |
T |
 |
| Q |
201 |
gcatgacgtggatggaagtttaactcagaaaagc |
234 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
48171552 |
gcatgaagtggatggaagtttaactcagaaaagc |
48171519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University