View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13565_high_34 (Length: 238)
Name: NF13565_high_34
Description: NF13565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13565_high_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 23 - 225
Target Start/End: Complemental strand, 2928369 - 2928167
Alignment:
| Q |
23 |
agcttttaaggaagatacttcagaaactaaataaatattttaagaatttatgagcaatgactctgtttatgctacttattcttccttatagataggttca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2928369 |
agcttttaaggaagatacttcagaaactaaataaatattttaagaatttatgagcaatgactctgtttatgctacttattcttccttatagataggttca |
2928270 |
T |
 |
| Q |
123 |
tgatcagtagccttaagttttctattgatgcatctatatcacctttgtaacattctattacgactatctaacaatgatctggtatggcttttttctgtgc |
222 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2928269 |
tgatcagtggccttaagttttctattgatgcatctatatcacctttgtaacattctattacgactatctaacagtgatctggtatggcttttttctgtgc |
2928170 |
T |
 |
| Q |
223 |
tgc |
225 |
Q |
| |
|
||| |
|
|
| T |
2928169 |
tgc |
2928167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 55 - 113
Target Start/End: Original strand, 2310927 - 2310985
Alignment:
| Q |
55 |
aaatattttaagaatttatgagcaatgactctgtttatgctacttattcttccttatag |
113 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| || |||||||||||||||| |
|
|
| T |
2310927 |
aaatattttaagaatttatgagcaatggctctgtttatgttaattattcttccttatag |
2310985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University