View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13565_high_36 (Length: 237)
Name: NF13565_high_36
Description: NF13565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13565_high_36 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 4333008 - 4333227
Alignment:
| Q |
18 |
catctgtcttcttttttgccctaaaaataaagttgtcttcttttgcacacaacagttcatgtaactaatgtttaaaattggagaaaagcatgcaaaagaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4333008 |
catctgtcttcttttttgccctaaaaataaagttgtcttcttttgcacacaacagttcatgtaactaatgtttaaaattggagaaacgcatgcaaaagaa |
4333107 |
T |
|
| Q |
118 |
tgatgattatgttctagatcgaggcacgcaaacgatagacttttgtgcattttaagactctgttccgcgcattatcttccttctatgcccttccatttcc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
4333108 |
tgatgattatgttctagatcgaggcacgcaaacgaaagacttttgtgcattttaagactctgttccgcgcattatcttccttcaaagcccttccatttcc |
4333207 |
T |
|
| Q |
218 |
cctattttactgttcttttt |
237 |
Q |
| |
|
| |||||||||||||||||| |
|
|
| T |
4333208 |
catattttactgttcttttt |
4333227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University