View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13565_high_42 (Length: 213)
Name: NF13565_high_42
Description: NF13565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13565_high_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 37748288 - 37748499
Alignment:
| Q |
1 |
tactttaatataatttcttatactctaacagcatacttttttctgtcaaacaagaccatatcttattatccaaacatgtgagaagatctaaatcatgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37748288 |
tactttaatataatttcttatactctaacagcatccttttttctgtcaaacaagaccatatcttattatccaaacatgtgagaagatctaaatcatgcaa |
37748387 |
T |
|
| Q |
101 |
tgtgaaactgtatattgactcatattttcagctattgttac----tatgaatagtttggaggaaaagagatgatcagatttaccggtgacaagtgctttc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37748388 |
tgtgaaactgtatattgactcatattttcagctattgttactatatatgaatagtttggaggaaaagagatggtcagatttaccggtgacaagtgctttc |
37748487 |
T |
|
| Q |
197 |
tgatgatgtcca |
208 |
Q |
| |
|
||| | |||||| |
|
|
| T |
37748488 |
tgaagctgtcca |
37748499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University