View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13565_low_16 (Length: 426)
Name: NF13565_low_16
Description: NF13565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13565_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 58 - 415
Target Start/End: Original strand, 13281785 - 13282142
Alignment:
| Q |
58 |
tatatttattttcaagtataagaggtagaagtatttgtttggttttacctgttttatttcattggttactctctttctatggcatattggactggttttt |
157 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13281785 |
tatatttattttcatgtataagaggtagaagtatttgtttggttttaccttttttatttcattggttactctctttctatggcatattggactggttttt |
13281884 |
T |
 |
| Q |
158 |
atttttattgtatggacgagatgtaatgtgaaaagtataagtttgaacttcaatatgattacaatgtatactctgattgtttctctgctttacttattta |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13281885 |
atttttattgtatggacgagatgtaatgtgaaaagtataagtttgaacttcaatatgattacaatgtatactctgattgtttctctgctttacttattta |
13281984 |
T |
 |
| Q |
258 |
tttatactaataataaatggtgatgtaatgaaagaagtaatagattgaactttaatacattatgctctttatatgtatccacaatatgcaatgtgttcac |
357 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13281985 |
tttatactaataacaaatggtgatgtaatgaaagaagtaaaagattgaactttaatacattatgccctttatatgtatccacaatatgcaatgtgttcac |
13282084 |
T |
 |
| Q |
358 |
tttaatacaatgtattctctttctggttcgctgctccgatcttcttcatcacaggttc |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |||| ||||| |
|
|
| T |
13282085 |
tttaatacaatgtattctctttctggttcgctgctctgatcttcttcctcaccggttc |
13282142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University