View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13565_low_18 (Length: 396)
Name: NF13565_low_18
Description: NF13565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13565_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 186 - 377
Target Start/End: Original strand, 49158722 - 49158913
Alignment:
| Q |
186 |
cggtagcatttcattcatgaaccaaaatatattatattcatcaccatctaaggtaatgcactcnnnnnnnctcaacatgcataaattacagagtaaaaat |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49158722 |
cggtagcatttcattcatgaaccaaaatatattatattcatcaccatctaaggtaatgcactcaaaaaaactcaacatgcataaattacagagtaaaaat |
49158821 |
T |
|
| Q |
286 |
taagaaccctaaatttcgttaagcggtgaaacnnnnnnnntaagcaaaacagaaaagcggaatttagaatagagaggatcgaaagggaaaac |
377 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
49158822 |
taagaaccctaaatttcgttaagctgtgaaacaaaaaaaataagcaaaacagaaaagcagaatttagaatagagaggatcgaaagggaaaac |
49158913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 9 - 61
Target Start/End: Original strand, 49158544 - 49158596
Alignment:
| Q |
9 |
acatcatcatcaaaagggtcaacacaccaacacacattcttcaaactccagac |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49158544 |
acatcatcatcaaaagggtcaacacaccaacacacattcttcaaactccagac |
49158596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University