View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13565_low_32 (Length: 285)
Name: NF13565_low_32
Description: NF13565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13565_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 17 - 275
Target Start/End: Original strand, 20527719 - 20527978
Alignment:
| Q |
17 |
tcatcaacgtttggaaccttggaagagaggatgatcaattcgtttcttgctctctaaatatcccaaatcactgaatgccacacaatttgaatccctcact |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20527719 |
tcatcaacgtttggaaccttggaagagaggatgatcaattcgtttcttgctctctaaatatcccaaatcactgaatgccacgcaatttgaatccctcact |
20527818 |
T |
 |
| Q |
117 |
acctttaccccttcgtagtggagctataattcacttcaacgattaacatatctctccagacaagagttttagtattctaatcctcct-aattttttgtgg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||||| |
|
|
| T |
20527819 |
acctttaccccttcgtagtggagctataaagcacttcaacgattaacatatctctccagacaagagctttagtattctaatccacctaaattttttgtgg |
20527918 |
T |
 |
| Q |
216 |
cacaccttccccacaaattgtctttttgtaaataaatcgttttccgattcatttgactct |
275 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20527919 |
cacaccttccccacaaattgtcattttgtaagtaaatcgttttccgattcatttgactct |
20527978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University