View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13565_low_40 (Length: 234)

Name: NF13565_low_40
Description: NF13565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13565_low_40
NF13565_low_40
[»] chr8 (2 HSPs)
chr8 (1-213)||(37113406-37113618)
chr8 (1-213)||(37126144-37126356)


Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 37113618 - 37113406
Alignment:
1 ctgaattggtgggacttgatgtggttcggtatgggcgccgtcattggttctggaatatttgtgcttaccggacttgaggctaggcaggaagcaggtccgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37113618 ctgaattggtgggacttgatgtggttcggtatgggcgccgtcattggttctggaatatttgtgcttaccggacttgaggctaggcaggaagcaggtccgg 37113519  T
101 cagttgtattgtcgtttgtcatctccggtatatctgctttgctatcggtgttttgttatacagaatttgctgtggaaattccggttgcaggtactttctc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37113518 cagttgtattgtcgtttgtcatctccggtatatctgctttgctatcggtgttttgttatacagaatttgctgtggaaattccggttgcaggtactttctc 37113419  T
201 ttaccctcactat 213  Q
    |||||||||||||    
37113418 ttaccctcactat 37113406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 37126356 - 37126144
Alignment:
1 ctgaattggtgggacttgatgtggttcggtatgggcgccgtcattggttctggaatatttgtgcttaccggacttgaggctaggcaggaagcaggtccgg 100  Q
    ||||| |||||||||||||||||||| ||||| || || ||| | || || |||||||||||||| |||||||||||||||| |||| | ||||||||||    
37126356 ctgaactggtgggacttgatgtggtttggtatcggtgcggtcgtcggctccggaatatttgtgctgaccggacttgaggctaagcagcatgcaggtccgg 37126257  T
101 cagttgtattgtcgtttgtcatctccggtatatctgctttgctatcggtgttttgttatacagaatttgctgtggaaattccggttgcaggtactttctc 200  Q
    ||||||| ||||| |||||||||||||| |||||||||||| |||| || ||||| |||||||| ||||| |||||||||||||||||||||||||||||    
37126256 cagttgtgttgtcatttgtcatctccggcatatctgctttgttatcagtattttgctatacagagtttgcggtggaaattccggttgcaggtactttctc 37126157  T
201 ttaccctcactat 213  Q
    |||  ||||||||    
37126156 ttattctcactat 37126144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University