View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13566_high_4 (Length: 262)
Name: NF13566_high_4
Description: NF13566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13566_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 41 - 244
Target Start/End: Original strand, 5055049 - 5055252
Alignment:
| Q |
41 |
cttgtttgattcatgtgtacaaaatatgatttacaatgggtatttacagacttagaatacctaagcaacctaaattaacactgtttgccatatttttggt |
140 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5055049 |
cttgtttgattgatgtgtacaaaatatgatttacaatgggtatttacagacttagaatacctaagcaacctacattaacactgtttgccatatttttggt |
5055148 |
T |
 |
| Q |
141 |
ccattaactatcatattatatcatgtaatatcaagactaacattactacggttggtaattactctgtaggctgagctatacatcccaaaattatctctac |
240 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5055149 |
ccattaactatcatattacatcatgtaatatcaagactaacatgactacggttggtaattactctgtaggctgagctatacatcccaaaattatctctac |
5055248 |
T |
 |
| Q |
241 |
cact |
244 |
Q |
| |
|
|||| |
|
|
| T |
5055249 |
cact |
5055252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University