View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13566_high_5 (Length: 257)
Name: NF13566_high_5
Description: NF13566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13566_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 11 - 238
Target Start/End: Complemental strand, 41024454 - 41024227
Alignment:
| Q |
11 |
cacagacattaattcttcaaaattacgactttatcctttgtcaaatttcctatagagagagacccaaaaacaacaaaaaagcgaaacaccgttgtatgaa |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41024454 |
cacaaacattaattcttcaaaattacgactttatcctttgtcaaatttcctatagagagagacccaaaaacaacaaaaaagcgaaacaccgttgtatgaa |
41024355 |
T |
 |
| Q |
111 |
ctgtcaaatgctggcgacccatttgtaacgcggtggctctgccacaaaccacctttcaaaaaatgggttccggtcagattagcggcggcgttggcggtgg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41024354 |
ctgtcaaatgctggcgacccatttgtaacgcggtggctctgccacaaaccacctttcaaaaaatgggttccggtcagattagcggcggcgttggcggtgg |
41024255 |
T |
 |
| Q |
211 |
ttctcatactaacaacggcggtggtagt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41024254 |
ttctcatactaacaacggcggtggtagt |
41024227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University