View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13566_low_10 (Length: 250)
Name: NF13566_low_10
Description: NF13566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13566_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 25 - 231
Target Start/End: Original strand, 8542313 - 8542519
Alignment:
| Q |
25 |
catgtcgaagaaaataggaatacggcataatcaagagggtgtcgattgtaggaagtagtgtttcagctaaccaaccaacacatttagctagatttgatgc |
124 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8542313 |
catgtccaacaaaataggaatacggcataatcaagagggtgtcaattgtaggaagtagtgtttcagctaaccaaccaacacatttagctagatttgatgc |
8542412 |
T |
|
| Q |
125 |
ttttgagcattttttaaatgagaaactccaatagatcataaaaatgagattgagaggtatttggatgaagacaacatgaatggagacaataagtttaaac |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8542413 |
ttttgagcattttttaaatgagaaactccaatagatcataaaaatgagattgagaggtatttggatgaagacaacatgaatggagacaataagtttaaac |
8542512 |
T |
|
| Q |
225 |
tagttgt |
231 |
Q |
| |
|
||||||| |
|
|
| T |
8542513 |
tagttgt |
8542519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 164 - 206
Target Start/End: Complemental strand, 8543255 - 8543213
Alignment:
| Q |
164 |
aaaaatgagattgagaggtatttggatgaagacaacatgaatg |
206 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8543255 |
aaaaatgagattgagtggtatttggatgaagacaacatgaatg |
8543213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University