View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13566_low_11 (Length: 249)
Name: NF13566_low_11
Description: NF13566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13566_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 5055015 - 5054769
Alignment:
| Q |
1 |
cttctatttatttttcatgtcttcttagatagtagttcatccttcaacaatgggtgttctttggtgtagtctaagaacccgtagacgagaaacatgatct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
5055015 |
cttctatttatttttcatgtcttcttagatagtagttcatccttcaacactgggtgttctttggtgtagtctaagaacccgcagatgagaaacatgatct |
5054916 |
T |
|
| Q |
101 |
tttgtgggtgtaatcacttaaataaaaagagaatcattgtcacacgtgcaagttggccttc---atcttataagttaaacatacaatgaatcaagcacaa |
197 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| || |||||||||||||||||||| | ||||||||||||| |
|
|
| T |
5054915 |
tttgtgggtgcaatcacttaaataaaaagggaatcattgtcacacgtgcaagttggccatcatgatcttataagttaaacatacgacgaatcaagcacaa |
5054816 |
T |
|
| Q |
198 |
acgattaatcatacgtctaatcagttaaacacgaaatttcttatcac |
244 |
Q |
| |
|
|||||| ||||||| ||||||||| ||||||||||||||| |||||| |
|
|
| T |
5054815 |
acgattgatcatacatctaatcagctaaacacgaaatttcgtatcac |
5054769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 9021058 - 9021097
Alignment:
| Q |
7 |
tttatttttcatgtcttcttagatagtagttcatccttcaa |
47 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
9021058 |
tttattttt-atgtcttcttagataatagttcatccttcaa |
9021097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University