View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13566_low_13 (Length: 204)
Name: NF13566_low_13
Description: NF13566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13566_low_13 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 1e-98; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 19 - 204
Target Start/End: Complemental strand, 51360389 - 51360204
Alignment:
| Q |
19 |
atcataggttgtgttcctgctctaggagcagatcaatttgatgatatgaatccaaaagaatatctccaactagcaagcttcttcaattggtttttgttta |
118 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51360389 |
atcagaggttgtgttcctgctctaggagcagatcaatttgatgatatgaatccaaaagaatatctccaactagcaagcttcttcaattggtttttgttta |
51360290 |
T |
 |
| Q |
119 |
gtattacaattggtgctagcttaggtgtcacttttgtagtttatgttagcacaatcttcgattggtacaaaggttttcttatatct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51360289 |
gtattacaattggtgctagcttaggtgtcacttttgtagtttatgttagcacaatcttcgattggtacaaaggttttcttatatct |
51360204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 51351020 - 51350938
Alignment:
| Q |
19 |
atcataggttgtgttcctgctctaggagcagatcaatttgatgatatgaatccaaaagaatatctccaactagcaagcttctt |
101 |
Q |
| |
|
|||| ||| |||||||||||||||||||| |||||||||||||| | ||||||||| || |||||||||||| |||||||| |
|
|
| T |
51351020 |
atcaaaggctgtgttcctgctctaggagctgatcaatttgatgacaagaatccaaaggaccgtctccaactagctagcttctt |
51350938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 135 - 204
Target Start/End: Complemental strand, 51350919 - 51350850
Alignment:
| Q |
135 |
tagcttaggtgtcacttttgtagtttatgttagcacaatcttcgattggtacaaaggttttcttatatct |
204 |
Q |
| |
|
||||||||||| ||| ||||||||| ||||||| || ||| | |||||||||||||||||||||||| |
|
|
| T |
51350919 |
tagcttaggtgccacctttgtagttcatgttagatcacaattcaaatggtacaaaggttttcttatatct |
51350850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University