View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13567_high_5 (Length: 367)
Name: NF13567_high_5
Description: NF13567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13567_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 19 - 363
Target Start/End: Complemental strand, 39765333 - 39764990
Alignment:
| Q |
19 |
attcttaccatgaaaatcaaagttctattttatatctcacaatgcaccagctagatagattgacaaaggtcaattgctgtcactcattctagaattgttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39765333 |
attcttaccatgaaaatcaaagttctattttatatctcacaatgcaccagctagatagattgacaaaggtcaattgctgtcactcattctagaattgttc |
39765234 |
T |
 |
| Q |
119 |
taagctaaacacgtttattagagttctaagctaggcggaaaaatgttgtattttattgatatatgcagcactaatagnnnnnnnaaaacttttcttaatt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39765233 |
taagctaaacacgtttattagagttctaagctaggcggaaaaatgttgtattttattgatatatgcagcactaatag-ttttttaaaacttttcttaatt |
39765135 |
T |
 |
| Q |
219 |
tgtctatactgttttattgacatagttttggttcttttcacaaactattatatgttgggggtggtatgggatgcatgtttctccgctccgtattcatcca |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39765134 |
tgtctatactgttttattgacatagttttggttcttttcacaaactattatatgttgggggtggtatgggatgcatgtttctccactccgtattcatcca |
39765035 |
T |
 |
| Q |
319 |
ctttttgttgcactcttttatttccttacctttttcttctcactc |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39765034 |
ctttttgttgcactcttttatttccttacctttttcttttcactc |
39764990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University