View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13567_low_11 (Length: 213)

Name: NF13567_low_11

Description: NF13567

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF13567_low_11

[»] chr1 (1 HSPs)

[»] chr8 (1 HSPs)

Target: chr1 (Bit Score: 120; Significance: 1e-61; HSPs: 1)

Name: chr1

Description:

Target: chr1; HSP #1

Raw Score: 120; E-Value: 1e-61

Query Start/End: Original strand, 18 - 199

Target Start/End: Complemental strand, 7234411 - 7234226

Alignment:

Q	18	gaattcactgcgtattgaaaaattcaacccttttt-gcatatatgcagatgtcgtggttcaaattccggacacttcatttctctacgtttataatatgtg	116	Q
		\|\|\|\|\|\|\| \| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \| \|\|\|\|\| \|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|
T	7234411	gaattcatttcgtattgaaaaattcaaccattttttgcatatatgcagatgttggggttcgaatttcggacacttcatttctctacatttataatatgtg	7234312	T

Q	117	agctctagtcactaaga---tatttgaccaaaatttcaacctcttttggtagtataatcattggtttattgtttgcttcattttct	199	Q
		\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|
T	7234311	agctctagttactaagaagatatttgaccaaaatctcaacctcttttggtagtataatcattggtttattgtttgcttcatattct	7234226	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)

Name: chr8

Description:

Target: chr8; HSP #1

Raw Score: 31; E-Value: 0.00000002

Query Start/End: Original strand, 56 - 130

Target Start/End: Complemental strand, 8827929 - 8827855

Alignment:

Q	56	tatatgcagatgtcgtggttcaaattccggacacttcatttctctacgtttataatatgtgagctctagtcacta	130	Q
		\|\|\|\|\|\|\|\|\|\| \|\|\|\| \|\|\|\|\| \|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\| \|\| \| \| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	8827929	tatatgcagaggtcggggttcgaatcccggacacttcatttctccacaatttaattgtgtgagctctagtcacta	8827855	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]