View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13568_low_5 (Length: 316)
Name: NF13568_low_5
Description: NF13568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13568_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 2 - 299
Target Start/End: Original strand, 14991326 - 14991623
Alignment:
| Q |
2 |
aggggtagagtttgcgagtatcctggtgcgaaatgtgttcagtataggggtgagtgttatacgacatgtgaaggtattccttctgaattactctactcaa |
101 |
Q |
| |
|
||||| ||||||||||||| ||||| || |||| ||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14991326 |
aggggaagagtttgcgagtgtcctgttgtgaaaggtgttcagtataggggtgatggttatacgtcatgtgaaggtattccttctgaattactctactcaa |
14991425 |
T |
 |
| Q |
102 |
aattctaaaaagttacctcttcctattatcagtcactacctgattactctactcaaaatgataagctattttcctcgttgctgatatgttgtttattctt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14991426 |
aattctaaaaagttacctcttcctattatcagtcactacctgattactctactcaaaatgataagctattttcctcgttgctgatatgttgtttattctt |
14991525 |
T |
 |
| Q |
202 |
ttctttatttgacagcttttggacctgcaagatgttctttaaacaatggaggttgttggtcagaaactagagataaaattactttctccgcttgttca |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14991526 |
ttctttatttgacagcttttggacctgcaagatgttctttaaacaatggaggttgttggtcagaaactagagataaaattactttctccgcttgttca |
14991623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University