View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1356_low_14 (Length: 325)
Name: NF1356_low_14
Description: NF1356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1356_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 27 - 296
Target Start/End: Complemental strand, 21272007 - 21271738
Alignment:
| Q |
27 |
gattattctcgtaattaaagaacaacttgatcaatctggctagctttatgttagtcatctgattgctccgtagaaaaattgaagttgatgttgatgttgg |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21272007 |
gattattctcgtaattaaagaacaacttgatcaatctggccagctttatgttagtcatctgattgctccgtagaaaaattgaagttgatgttgatgttgg |
21271908 |
T |
 |
| Q |
127 |
ttttgtgcgatttgaatttttatcgcctcgacggtgtcgtgatttgaggattcggtcttcatggcgatgaggtagtggagaaggatgcgactcagatttt |
226 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21271907 |
ttttgtgagatttgaatttttatcgcctcgatggtgtcgtgatttgaggattcggtcatcatggcgatgaggtagtggagaaggatgcgactcagatttt |
21271808 |
T |
 |
| Q |
227 |
atgtgttatgtgttatggttttttaaatgaggtagtgcagaaagtaggactatcagactagggttagatt |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
21271807 |
atgtgttatgtgttatggttttttaaatgaggtagtgaagaaagtacgactatcagactagggttagatt |
21271738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 129 - 202
Target Start/End: Original strand, 10815677 - 10815751
Alignment:
| Q |
129 |
ttgtgcgatttgaatttttatcgcctcgacggtgtcgtgatttgaggattcggtcttcat-ggcgatgaggtagt |
202 |
Q |
| |
|
|||||||||||||| ||| || |||| ||||| |||||||| ||||||||| || |||| |||||||||||||| |
|
|
| T |
10815677 |
ttgtgcgatttgaagtttcatagccttgacggcgtcgtgatcggaggattcgatcatcatgggcgatgaggtagt |
10815751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 128 - 194
Target Start/End: Complemental strand, 23693127 - 23693061
Alignment:
| Q |
128 |
tttgtgcgatttgaatttttatcgcctcgacggtgtcgtgatttgaggattcggtcttcatggcgat |
194 |
Q |
| |
|
||||||||||||||| ||| || |||| ||||| |||||||| |||||||||||| || ||||||| |
|
|
| T |
23693127 |
tttgtgcgatttgaagtttcatagccttgacggcgtcgtgatcggaggattcggtcatcgtggcgat |
23693061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University