View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1356_low_20 (Length: 300)
Name: NF1356_low_20
Description: NF1356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1356_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 14 - 220
Target Start/End: Original strand, 54827517 - 54827711
Alignment:
| Q |
14 |
gagacgaacatggaaacccaattcaactaactgatgaattgggtaacccagttaagttaactgacgaacatggaaaccctatccatctcaccggtgtagc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
54827517 |
gagacgaacatggaaacccaattcaactaactgatgaattgggtaacccagttaagttaactgacgaacatggaaacccgatccatctcaccggtgtagc |
54827616 |
T |
|
| Q |
114 |
aaccactaccacaactaataataatcctccaactgcagcaggttcaggttcaggttcaggttcagctggttttggcacctatggtagcgttgcttacggt |
213 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54827617 |
aaccactaccacaactcataataatcctccaactgcag------------caggttcaggttcagctggttttggcacctatggtagcgttgcttacggt |
54827704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University