View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1356_low_24 (Length: 275)
Name: NF1356_low_24
Description: NF1356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1356_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 37 - 243
Target Start/End: Complemental strand, 1110061 - 1109854
Alignment:
| Q |
37 |
tccttagcgttggtgcatctctttgcctttcttctgaaacaagaactttgagtgtaagttagtacaagtttatgnnnnnnn-tccaaaagcttatagtct |
135 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
1110061 |
tccttagagttggtgcatctctttgcctttcttctgaaataggaactttgagtgtaagttagtaccagtttatgaaaaaaaatccaaaagcttatagtct |
1109962 |
T |
|
| Q |
136 |
atatagaattttcatttcactttatgaaaaaatgaaacagttttcttacctgagattgttctgatttgttacaggtgccaatagcaaatgcaatcttttt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1109961 |
atatagaattttcatttcactttatgaaaaaatgaaacagttttcttacctgatattgttctgatttgttacaggtgcctatagcaaatgcaatcttttt |
1109862 |
T |
|
| Q |
236 |
ctgtggtg |
243 |
Q |
| |
|
|||||||| |
|
|
| T |
1109861 |
ctgtggtg |
1109854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University