View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1356_low_32 (Length: 254)
Name: NF1356_low_32
Description: NF1356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1356_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 11 - 129
Target Start/End: Original strand, 41798163 - 41798284
Alignment:
| Q |
11 |
cgaataatatgatatatgtgtttgtcttg---gataagttcatatatgtgtgtatttactaagcaggtaacataatccaaagattttgaactgtccacga |
107 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41798163 |
cgaataatatgatatatatgtttgtcttgttggataagttcatatatgtgtgtatttactaagcaggtaagataatccaaagattttgaactgtccacga |
41798262 |
T |
 |
| Q |
108 |
gtatatcatcgtatctatgata |
129 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41798263 |
gtatatcatcgtatctatgata |
41798284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University