View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1356_low_32 (Length: 254)

Name: NF1356_low_32
Description: NF1356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1356_low_32
NF1356_low_32
[»] chr5 (1 HSPs)
chr5 (11-129)||(41798163-41798284)


Alignment Details
Target: chr5 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 11 - 129
Target Start/End: Original strand, 41798163 - 41798284
Alignment:
11 cgaataatatgatatatgtgtttgtcttg---gataagttcatatatgtgtgtatttactaagcaggtaacataatccaaagattttgaactgtccacga 107  Q
    ||||||||||||||||| |||||||||||   |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
41798163 cgaataatatgatatatatgtttgtcttgttggataagttcatatatgtgtgtatttactaagcaggtaagataatccaaagattttgaactgtccacga 41798262  T
108 gtatatcatcgtatctatgata 129  Q
    ||||||||||||||||||||||    
41798263 gtatatcatcgtatctatgata 41798284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University