View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1356_low_34 (Length: 251)

Name: NF1356_low_34
Description: NF1356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1356_low_34
NF1356_low_34
[»] chr3 (1 HSPs)
chr3 (1-244)||(53763662-53763905)
[»] chr2 (1 HSPs)
chr2 (129-198)||(3919856-3919925)


Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 53763662 - 53763905
Alignment:
1 aacctcagtattttttataatttctttttaggcttcatatactgggtgtaagtggtttagacaaaacgaacagaaattccaaatcgaaaaagtattgact 100  Q
    ||||| |||||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||    
53763662 aaccttagtattttttataatttctttttaggcttcatataccgggcgtaagtggttcagacaaaacgaacaaaaattccaaatcgaaaaagtattgact 53763761  T
101 ttgtttggttcggtttgaaccgacctacccgatctagtttagtttggtattttatgcttgatgttgagatctaaagaacggatgaaccgaaccaatgcct 200  Q
    ||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||||||||||| |||| ||||| ||||| |    
53763762 ttgtttggttcggtttgaaccgacctaaccgatctagtttaatttggtattttatgcttgatgtcgagatctaaagaacggctgaatcgaactaatgctt 53763861  T
201 atcatatcccttcaatttactaatatcattcattcttcatctca 244  Q
    ||||||||||||||||||||||||||||||||||||||| ||||    
53763862 atcatatcccttcaatttactaatatcattcattcttcacctca 53763905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 129 - 198
Target Start/End: Complemental strand, 3919925 - 3919856
Alignment:
129 ccgatctagtttagtttggtattttatgcttgatgttgagatctaaagaacggatgaaccgaaccaatgc 198  Q
    |||||||||||| |||||||  || ||  || || |||||||||||||||| ||||||||||||| ||||    
3919925 ccgatctagtttggtttggttcttaatttttaattttgagatctaaagaaccgatgaaccgaaccgatgc 3919856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University