View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1356_low_34 (Length: 251)
Name: NF1356_low_34
Description: NF1356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1356_low_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 53763662 - 53763905
Alignment:
| Q |
1 |
aacctcagtattttttataatttctttttaggcttcatatactgggtgtaagtggtttagacaaaacgaacagaaattccaaatcgaaaaagtattgact |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
53763662 |
aaccttagtattttttataatttctttttaggcttcatataccgggcgtaagtggttcagacaaaacgaacaaaaattccaaatcgaaaaagtattgact |
53763761 |
T |
|
| Q |
101 |
ttgtttggttcggtttgaaccgacctacccgatctagtttagtttggtattttatgcttgatgttgagatctaaagaacggatgaaccgaaccaatgcct |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||||||||||| |||| ||||| ||||| | |
|
|
| T |
53763762 |
ttgtttggttcggtttgaaccgacctaaccgatctagtttaatttggtattttatgcttgatgtcgagatctaaagaacggctgaatcgaactaatgctt |
53763861 |
T |
|
| Q |
201 |
atcatatcccttcaatttactaatatcattcattcttcatctca |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53763862 |
atcatatcccttcaatttactaatatcattcattcttcacctca |
53763905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 129 - 198
Target Start/End: Complemental strand, 3919925 - 3919856
Alignment:
| Q |
129 |
ccgatctagtttagtttggtattttatgcttgatgttgagatctaaagaacggatgaaccgaaccaatgc |
198 |
Q |
| |
|
|||||||||||| ||||||| || || || || |||||||||||||||| ||||||||||||| |||| |
|
|
| T |
3919925 |
ccgatctagtttggtttggttcttaatttttaattttgagatctaaagaaccgatgaaccgaaccgatgc |
3919856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16065 times since January 2019
Visitors: 1179