View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1356_low_36 (Length: 226)
Name: NF1356_low_36
Description: NF1356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1356_low_36 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 7 - 226
Target Start/End: Complemental strand, 46992916 - 46992681
Alignment:
Q |
7 |
gcaggtcataactatcattaagaggcgaattagtgaagaatgcactctcgaggtttatcatatgcataacattattttattgccaccgcacaggagtgtt |
106 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46992916 |
gcaggtcataactatcattaagaggcgaattagtgaagaatgcactctctaggtttatcatatgcataacattattttattgccaccgcacaggagtgtt |
46992817 |
T |
 |
Q |
107 |
tattcaatataaaaa-tgtg---------------caatttggtctctaaaattgtaatgttgtatcaacctaatctctttattaatattccaaagtgat |
190 |
Q |
|
|
||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
46992816 |
tattcaatataaaaattgtgcaatttggtgttggtcaatttggtctctaaaattgtaatgttgtatcaacctactctctttattaatattccaaagtgat |
46992717 |
T |
 |
Q |
191 |
ttatgaaattacaaaatgctaatatattcgtccctc |
226 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
46992716 |
ttatgaaattacaaaatgctaatatattcgtccctc |
46992681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University