View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1356_low_38 (Length: 202)
Name: NF1356_low_38
Description: NF1356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1356_low_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 41067739 - 41067645
Alignment:
Q |
1 |
ggtatctaatcacatttatataaaaattaaatcattcagggag-nnnnnnnnngtagtaggataaatattctgacaatgaaaattaacaagtcag |
94 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
41067739 |
ggtatctaatcacatttatataaaaattaaatcattcagggagaacaaaaaaagtattaggataaatattctgacaatgaaaattaacaagtcag |
41067645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University