View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13571_low_5 (Length: 327)
Name: NF13571_low_5
Description: NF13571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13571_low_5 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 216 - 327
Target Start/End: Original strand, 9450968 - 9451077
Alignment:
| Q |
216 |
agacataggttataatagcctgccttacttttagaaatttgattttcatggcaaacaaagaaaattgggatgaaaaccacaatcccaataagctttatta |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9450968 |
agacataggttataatagcctgccttacttttagaaatttgattttcatggcaaac--agaaaattgggatgaaagccacaatcccaataagctttatta |
9451065 |
T |
|
| Q |
316 |
tcattgtttatt |
327 |
Q |
| |
|
|||||||||||| |
|
|
| T |
9451066 |
tcattgtttatt |
9451077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University